| TrapCLuster Report for TCL16640 |
| Internal ID | 16640 |
||||
| Accession | TCL16640 |
||||
| Sequence |
|
||||
| RNA length | 268 |
||||
| Overlapping | |||||
| Blocks | 2 |
||||
| Traps | 8 |
||||
| Distance from gene | 21606 |
||||
| Gene in slice | 1 |
||||
| Gene in slice (same strand) | 0 |
||||
| Human Conservation | 0 |
||||
| Dog Conservation | 0 |
||||
| Gallus Conservation | 0 |
||||
| Total Conservation | 0 |
||||
| LORF Length | 33 |
||||
| LORF-Blastp Result | 0 |
||||
| UTRscan Result | 0 |
||||
| Max UTR length | 0 |
||||
| Closest Gene (stable_id) | ENSMUSG00000039826 |
||||
| Closest Gene (name) | Trub2 |
||||
| Close to OMIM | 0 |
||||
| Disease | 0 |
||||
| Go To Ensembl |  |
||||
| Go To UCSC |  |
| Sorry, no results for your search. |
| Longest ORF | Translation | Length | Strand |
| ggagacagacctactgacgacctcaacagcacctccctcc caggctcacccagggacaggttgagtgaaagagcagtggc tgagatgaatacaGCTGAGT |
GDRPTDDLNSTSLPGSPRDRLSERAVAEMNTAE |
33 | + |
| BLASTP Hit ID (ORF) | Description | Score | Start | End | Frac Aligned Query | Num Hsps | Frac Identical | Length | |
| No BLASTP result for Longest-ORF! | |||||||||
| Public Clones | |||
| Private Clones | OST242726 (lexicon) OST179878 (lexicon) OST441632 (lexicon) OST191342 (lexicon) OST275631 (lexicon) OST279255 (lexicon) OST302907 (lexicon) OST174924 (lexicon) |
||