| Internal ID | 20963 |
| Accession | TCL20963 |
| Sequence | ctaactgttgtttttcaattcattaccgtgagccctctgtgggtatgagaaactagccagatacatgcatgtgta |
| RNA length | 75 |
| Overlapping | |
| Blocks | 1 |
| Traps | 2 |
| Distance from gene | 119104 |
| Gene in slice | 1 |
| Gene in slice (same strand) | 0 |
| Human Conservation | 0 |
| Dog Conservation | 0 |
| Gallus Conservation | 0 |
| Total Conservation | 0 |
| LORF Length | 24 |
| LORF-Blastp Result | 0 |
| UTRscan Result | 0 |
| Max UTR length | 0 |
| Closest Gene (stable_id) | ENSMUSG00000028878 |
| Closest Gene (name) | BC008163 |
| Close to OMIM | 0 |
| Disease | 0 |
| Go To Ensembl |  |
| Go To UCSC |  |